Histogram with FASTA file

I am new to Linux. I have a FASTA file that looks something like this: ~~~ >scaffold1 AAGACATAATATTTTGGAGGAATTAAAAAATTTAAGATGTATTTTATTATACATGTATTTTATTTATAACATAAATAAACATCCCAAGGAAAAGCAGTAGCT >scaffold2 AAGGATAAGTGTAGCTGAGGAATTAAAAAATTTAACAAATAAAATTAATGCAATTTATTTTTTCAAATAAAAATACACGGAGAAAAATAATTTGTAAATTTT ~~~ etc. This goes on to about 5000+ scaffolds. I want to make a histogram with the scaffold lengths. I read about Biopython etc. but I don't know anything about installing these programs. Is there a way to get a histogram with just the Linux commands (terminal) or with R? Thank you