I have many data files in a directory. Each data file has various columns and I want vector plots using a few of them. Earlier I was generating .png files using a .gp script and combining them into a movie. I need outputs in PDF format also for showing in presentation and including in articles. The png script is:

set terminal pngcairo
set xla 'x'
set yla 'y'
scl=3
do for [i=0:10000:200]{
    set output sprintf('vector_frame%04.0f.png',i)
    plot 'data.'.i.'.dat' u 3:4:($5/scl):($6/scl) w vec ti sprintf("frame %d",i)
    set output

The resolution of png images is much poorer than that of the qt terminal and the plots are often not of much help. The pdf outputs from pdfcairo are also not good. In addition, there are situations where I have to `set size ratio 2'. There the _labels on the x-axis overlap_. The code and a sample output are given blow.

set terminal pngcairo
set xla 'x'
set yla 'y'
set size ratio 2
scl=3
set output 'pngeg.png'
plot 'data.2000.dat' u 3:4:($5/scl):($6/scl) w vec

I want to know what is the best way to save gnuplot vector plots in a form which is closest to the qt output and of good resolution. I need to do thousands of such plots in multiple directories. So a _script_ to do the same would be very helpful. I require outputs in **PDF** format. However, can pdf files be combined to make a movie or animation? Otherwise, I would need png images also. I am new to gnuplot and some detailed advice would be a saviour. Thank you.

How do I specify the **working directory** for **gnuplot** in interactive mode? If I want to call a script with "call 'label_loop.gnu'" and do not want to put the script file in the gnuplot installation folder, do I need to specify the full path each time? I think the following would be the case with normal usage. "I put the data or script I want to load in any directory"-> "I plot it in interactive mode"-> "I want to adjust the position of the label (preferably) with the mouse action"- > "I copy and paste the previous commands and I create a batch file"-> "GnuPlot converts the output to PDF"

I am new to Linux. I have a FASTA file that looks something like this: ~~~ >scaffold1 AAGACATAATATTTTGGAGGAATTAAAAAATTTAAGATGTATTTTATTATACATGTATTTTATTTATAACATAAATAAACATCCCAAGGAAAAGCAGTAGCT >scaffold2 AAGGATAAGTGTAGCTGAGGAATTAAAAAATTTAACAAATAAAATTAATGCAATTTATTTTTTCAAATAAAAATACACGGAGAAAAATAATTTGTAAATTTT ~~~ etc. This goes on to about 5000+ scaffolds. I want to make a histogram with the scaffold lengths. I read about Biopython etc. but I don't know anything about installing these programs. Is there a way to get a histogram with just the Linux commands (terminal) or with R? Thank you

I want to be able to plot an array of functions that are stored as a 2-d array using matplotlib. They all have the same independent variable. Specifically, P=zerros((ntotx, ntoty),float) x=zeros(ntotx,float) So that the x-array is the independent variable with ntotx values, and the P-array is the set of ntoty functions of x. I know I can break them out as individual functions, and plot them, but that makes for pretty clunky code.

I am using xmgrace to plot 2D bar plot from the following input data: @ title "H-bonds" @ xaxis label "Donor" @ yaxis label "Frac" @s0 line type 0 @s0 symbol linewidth 1 @s0 symbol fill pattern 1 @s0 symbol fill color 4 @TYPE bar @XAXIS TICK MAJOR 1 GLU_166@N 0.6865 HIE_163@NE2 0.4160 ASN_142@ND2 0.0788 THR_25@OG1 0.0109 as you may see all grace's options have already defined in the @ comments. so to produce the graph I need only to execute gracebat .dat -hdevice PNG -fixed 800 600 -world 0 0 5 1.0 -printfile test.png -hardcopy the problem is that the produced bar graph does not contain any information about the labels from the first columns (like THR_26@OG1 etc), producing something like 1) visualization of the X labels: how could I use the labels on the X from the original data file instead of the values printed on default 1,2,3 etc ? I found the possibility to rename manually the X labels in gui but still have not find the command for batch execution. 2) visualization of the Y labels: would it be possible to plot the values of the fraction (Y) just above each bar directly on the bar graph (now they are indicated only on the Y)?

When I try to plot anything in GNU Octave, I get this error.

octave:1> plot(linspace(1,2,30),linspace(1,1,30))
error: feval: /usr/lib/octave/5.2.0/oct/x86_64-pc-linux-gnu/__init_fltk__.oct: failed to load: libfltk_gl.so.1.3: cannot open shared object file: No such file or directory
error: called from
    graphics_toolkit at line 91 column 5
    figure at line 91 column 7
    newplot at line 117 column 10
    plot at line 222 column 9

One workaround is to use gnuplot instead of fltk, but the plots look better with fltk. It turned out that blas was replaced by openblas during installing Julia, and after installing blas (by removing julia and openblas) it works again. So, how to make fltk work with openblas?

Having a set of PDF files, lets say: in-01.pdf, in-02.pdf, in-03.pdf, ... I would like to combine all of them into a single one, forming an M x N matrix. The command montage allows for doing so (M and N should be integers): montage -mode concatenate -tile NxM in-*.pdf out.pdf The problem is the size of the resulting PDF is huge, while I would expect it to be (maybe just) a little bigger than the sum of all the input PDF sizes. I think montage is first converting the input PDFs to images and then creating the output PDF out of those images (so for example, the text in the original PDFs is not showed as text in the output PDF, but as an image with lower quality and bigger size). I guess there should be a way to do it (LATEX, for example, allows to insert a PDF image in another PDF without the need to convert it to an image first). I am looking for a command line alternative using free software tools under GNU/Linux systems. **NOTE**: we can asume those PDF files have all the same exact dimension (width and height). They are auto-generated PDF images normally consisting of a plot/graph (simple shapes line lines and rectangles) and a few text (title, labels...).

Here I have a data which I would to plot with line using Gnuplot. Using the code pl 'Sphere_ISOTEST_data.txt' w p I get below figure but, using pl 'Sphere_ISOTEST_data.txt' w l I get the following: Can anyone suggest as to how to sort the data such that I can plot w l and get only the circumference of the circle.

Closely related to https://unix.stackexchange.com/questions/283478/how-to-display-dependencies-given-in-a-makefile-as-a-tree But the answers given there is not satisfactory (i.e. do not work). Is there a tool to visualize the Directed Acylic Graphs (DAGs) coded up in standard Makefiles? eg, a shell-script for post-processing through Unix pipes can be an acceptable solution as well (maybe there is a pandoc filter to convert MakeFiles to graphviz or LaTeX). I don't strictly need a tool that directly typesets this graphical visualisation? Just a common file-format translation of the makefile to a graph-viz file or something similar would suffice.

I am using gracebat of xmgrace to generate images based on xvg inputs: gracebat input.xvg -hdevice PNG -nosafe -printfile ouptut.png -hardcopy -batch grace.bfile and here is my batch file s0 line type 0 s0 type BAR s0 line color 4 HARDCOPY DEVICE \"PNG\" PAGE SIZE 800, 600 xaxis label char size 2.50000 yaxis label char size 2.50000 xaxis ticklabel char size 2.000000 yaxis ticklabel char size 2.000000 Briefly it produces what I need but I would like to customuze in the batch.file design of the bar graphs. How it could be possible to set blue background for each bar (presently it is white) as well as to increase the thickness of the black line of the outline of each bar?

I have a set of data: 1.12158 0.42563 0.07 1.12471 0.42112 0.07 1.12784 0.41685 0.07 1.13097 0.41283 0.07 1.13409 0.40907 0.07 1.13722 0.40556 0.07 1.14035 0.40231 0.07 1.14348 0.39933 0.07 1.1466 0.39661 0.07 1.14973 0.39417 0.07 1.15285 0.39201 0.07 1.15598 0.39012 0.07 1.15911 0.38852 0.07 1.16224 0.3872 0.07 1.16536 0.38618 0.07 1.16849 0.38544 0.07 1.17162 0.385 0.07 1.17474 0.38486 0.07 1.17787 0.38543 0.07 1.181 0.38714 0.07 1.18413 0.38994 0.07 1.18725 0.39378 0.07 1.19038 0.39858 0.07 1.19351 0.40426 0.07 1.19664 0.41071 0.07 1.19976 0.41786 0.07 The first column is the x-axis and the second column is the y-axis. I want to fit this data to the equation: Ax^2 + Bx + c and find out the values of A, B and c. What program can I use ? I would be very glad if you could show me how to do it. Thanks.

I have created a systemd service like following code on my CentOS remote server that runs a Jupyter app named scraping-cdn-plot-gavahi-aati.ipynb that plots some charts. This is the service: [Unit] Description=Ipynb Script Service After=network.target [Service] Type=simple User=root ExecStart=/usr/bin/ipython /root/scraping-cdn-plot-gavahi-aati.ipynb Restart=on-abort [Install] WantedBy=multi-user.target I can run the service successfully and see this result when I start the service on the server: ● ipynb-script.service - Ipynb Script Service Loaded: loaded (/etc/systemd/system/ipynb-script.service; enabled; vendor preset: disabled) Active: active (running) since Mon 2020-05-18 11:56:04 +0430; 3s ago Main PID: 22796 (ipython) CGroup: /system.slice/ipynb-script.service └─22796 /root/anaconda3/bin/python /usr/bin/ipython /root/scraping-cdn-plot-gavahi-aati.ipynb May 18 11:56:04 boiga.server1.more.com systemd: Started Ipynb Script Service. But I don't know where should I see the plotted result? EDIT-Note: I can connect to the server through SSH and run the above Jupyter script using this address http://localhost:8000/notebooks/scraping-cdn-plot-gavahi-aati.ipynb(I use PUTTY on Windows 10 to do it). But what I am looking for is a way to connect a local installed application on my Windows like Spyder3 to connect to the remote server and see the plotting results.

Is there an easy way to make gnuplot automatically show y1=0 and y2=0 at the same height in the image while the y1 and y2 axes have different scales? The only way I am aware is to make sure the proportional distance from zero on the high and low bounds are the same for y1 and y2 For example set yrange [-1:2] and set y2range [-10:20] would work because -1 is to -10 as 2 is to 20. Here's an example #!/usr/bin/gnuplot -p set term wxt #not important unset key set autoscale set xrange [0:1] set xzeroaxis #shows a dotted line where y=0 for y1. set yrange[-1:2] #set y2range[-10:20] #if you set an explicit range, it obviously won't work unless you plan it perfectly (like this) #set y2range[-10:] #this does the minimum to get the plot in the frame (here -10 is the minimum, but the maximum seems to not really matter #set y2range[:20] #set y2range[:] #this is equivalent to just not having a set y2range line. set xtics 0.2 set ytics 0.3 set y2tics 1 set mxtics 5 set mytics 5 set my2tics 5 set ytics nomirror #makes y1tics only show up on the left f(x)=1 g(x)=10 plot f(x) axis x1y1 lc rgb 'blue', \ g(x) axis x1y2 lc rgb 'red';

I have a data file that is formatted as following: 1 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 1.000000 2 0.943177 1.305333 1.735536 1.797774 1.598829 1.737834 1.740041 1.912885 1.566793 2.019060 3 0.939475 1.358506 2.321663 1.853523 1.959409 2.510413 2.150453 2.398809 2.416171 2.565402 4 1.088087 1.123924 2.432605 2.590402 2.093655 3.088580 2.607818 3.159053 2.510439 2.821530 5 1.015587 1.258744 2.416498 2.580757 3.060878 2.942430 3.000413 3.253305 3.690752 3.959206 6 0.944150 1.315485 2.414785 2.574164 3.124374 4.351301 3.059047 3.702346 3.444113 4.392897 7 0.995709 1.645348 2.405321 2.613974 3.081145 4.353721 4.484388 3.194175 3.711591 4.668821 8 1.009326 1.492901 2.358513 2.523792 3.115867 4.392143 4.509854 5.086435 3.266735 4.590688 9 1.042647 1.327413 2.431767 2.577399 3.086926 4.381097 4.438063 5.144038 5.155699 4.230450 10 1.075849 1.291292 2.444103 2.584868 3.073117 4.328016 4.432163 5.145352 5.122751 7.421389 Those are 10 rows and 11 columns, with the first column being the values of the X-Axis. I want to draw a separate line for the values of every remaining column. The count of rows and columns can vary, since this is the output of a script. I want to plot those data using gnuplot. I tried > plot "< ./plotscript" matrix using 1:3:2 ever 1::1 with lines palette but that draws the rows as lines and not the columns.

So using gnuplot, and my code looks like this: set isosamples 40 unset key set title "Radial Matrix Elements" set xrange [1:15] set yrange [1:15] set xlabel "n1*" set ylabel "n2*" set zlabel 'R' splot 's1p.pun' u 1:2:4 with lines set view 135,135 replot The output looks like the image below. How do i get rid of the connecting lines and get the same look as if they weren't there?

I want a plotting script that will plot multiple graphs on the same plot where the values of my data have the same x coordinate. This will show the differences of each variable in the plot. I tried to plot using spreadsheet, but the plots are not clearly identifiable each other. My data looks like: x y1 y2 y3 y4 1 10 25 28 30 2 20 15 40 20 3 10 10 30 20 4 2 5 15 30 . . . .

On Libreoffice calc I have a spreadsheet that can compute certain quantities in time (hours). These quantities can be positive or negative. For example, the values in the spreadsheet can be a daily commuting time to work minus an average/nominal value. Thus a negative value in a certain day would indicate that the trip on that day was faster than usual. I have also created a plot to visualize this, but I cannot put the correct value on the y-axis. Somehow the values are set with a circular algebra, and if they are above 24 hours the labels on the y axis are resets to 0. Also, the negative values are shown as positive values, while I would like to show them with their sign. Any clue on how to correctly choose the labels for the y-axis? In the figures you see the plot, the y-axis options for that plot and part of the data used for the plot. As you can see, the values on the H column are measured in hours and minutes and they have a sign. Note also the discrepancy between the values on the H column, which are both positive and negative, and the ones in the y-axis, which are only positive.

I. I want to do a simple graph from timestamp YEAR-month-day to valuation, not wanting to use spreadsheets. Is there some ASCII tool for it to see it on CLI? There are over 500k lines of data, and I want to see only a sketch of it like in Ascii: Value | * | * * * | * * * * |* * |----------------------> Timestamp II. Then, I want to see allocation like in pizza slices: - - - -\ - - \ World - - Food \ Index - - / \ - - /oil \- - - - I know how-to-get grappy CSV data in Python but totally inexperienced in visualization: import csv csv_reader = csv.reader(open('data.csv', 'rb'), delimiter=';') for row in csv_reader: # do something with row.... Before I do my own ASCII visualization thing, I want to know whether such thing exists. How do you visualize your portfolio in ASCII?

Is there a program to graph (CPU) clockspeeds in real time? For example, something like psensor which is useful for temperature graphs. EDIT: Running Fedora 27 on a Ryzen system (Pinnacle Ridge)

I'm trying to plot the data of 100x11 array in plot using gnuplot. I created a .gnu file to generate plot but unable to get jitter plot. I'm using the below code set terminal pngcairo size 1280,800 enhanced font 'Helvetica,24' set output "coin_flip.png" # Title, axis label, range and ticks set title "Jitter plot of data from coin flip experiment" set xlabel "Fairness (p)" set ylabel "# of heads in 10 tosses" set xrange [-0.1:1.1] set yrange [-1:11] # Line styles set style line 1 lt -1 lw 4 pt 5 lc rgb "red" set style line 2 lt -1 lw 4 pt 7 lc rgb "blue" set style line 4 lt -1 lw 4 pt 7 lc rgb "green" set style line 5 lt -1 lw 4 pt 13 lc rgb "purple" set style line 6 lt -1 lw 8 pt 13 lc rgb "black" # Function definitions and curve fits set fit logfile 'coin_flip.log' #Fit plot "coin_flip.dat" using 1:2 ti "Fairness(p) vs # of Heads" ls 1 I'm getting below result But I'm trying to get as the below plot Can you please help me in plotting?